Metadata-Version: 1.1
Name: pydna
Version: 0.6.3
Summary: Contains classes and code for representing double
                     stranded DNA and functions for simulating homologous
                     recombination between DNA molecules.
Home-page: http://pypi.python.org/pypi/pydna/
Author: Björn Johansson
Author-email: bjorn_johansson@bio.uminho.pt
License: LICENSE.txt
Description: =====
        pydna
        =====
        
        Pydna provide functions for molecular biology using python.
        Double stranded DNA sequence classes that make cut and paste
        cloning and PCR very simple is provided (see example below).
        
        ::
        
            >>> import pydna
            >>> seq = pydna.Dseq("GGATCCAAA","TTTGGATCC",ovhg=0)
            >>> seq
            Dseq(-9)
            GGATCCAAA
            CCTAGGTTT
            >>> from Bio.Restriction import BamHI
            >>> a,b = seq.cut(BamHI)
            >>> a
            Dseq(-5)
            G
            CCTAG
            >>> b
            Dseq(-8)
            GATCCAAA
                GTTT
            >>> a+b
            Dseq(-9)
            GGATCCAAA
            CCTAGGTTT
            >>> b+a
            Dseq(-13)
            GATCCAAAG
                GTTTCCTAG
            >>> b+a+b
            Dseq(-17)
            GATCCAAAGGATCCAAA
                GTTTCCTAGGTTT
            >>> b+a+a
            Traceback (most recent call last):
              File "<stdin>", line 1, in <module>
              File "/usr/local/lib/python2.7/dist-packages/pydna/dsdna.py", line 217, in __add__
                raise TypeError("sticky ends not compatible!")
            TypeError: sticky ends not compatible!
            >>>
        
        Notably, homologous recombination and Gibson assembly between linear
        DNA fragments can be easily simulated.
        
        Most functionality is implemented as methods for the double stranded
        DNA sequence record classes Dseq and Dseqrecord, which are subclasses
        of the `Biopython <http://biopython.org/wiki/Main_Page>`_
        `Seq <http://biopython.org/wiki/Seq>`_
        and
        `SeqRecord <http://biopython.org/wiki/SeqRecord>`_ classes.
        
        Pydna was designed to provide a form of executable documentation
        describing a subcloning or DNA assembly experiment. The pydna code
        unambiguously describe a sub cloning experiment, and can be executed
        to yield the sequence of the of the resulting DNA molecule.
        
        Pydna was designed to semantically imitate how sub cloning experiments are
        typically documented in Scientific literature. Pydna code describing a
        sub cloning is reasonably compact and meant to be easily readable.
        
        The nine lines of Python below, simulates the construction of a recombinant
        plasmid. DNA sequences are downloaded from Genbank by accession numbers that
        are guaranteed to be stable.
        
        ::
        
            import pydna
        
            gb = pydna.Genbank("myself@email.com") # Tell Genbank who you are!
        
            gene = gb.nucleotide("X06997") # Kluyveromyces lactis LAC12 gene for lactose permease.
        
            primer_f,primer_r = pydna.parse(''' >760_KlLAC12_rv (20-mer)
                                                ttaaacagattctgcctctg
        
                                                >759_KlLAC12_fw (19-mer)
                                                aaatggcagatcattcgag
                                                ''', ds=False)
        
            pcr_prod = pydna.pcr(primer_f,primer_r, gene)
        
            vector = gb.nucleotide("AJ001614") # pCAPs cloning vector
        
            from Bio.Restriction import EcoRV
        
            lin_vector = vector.linearize(EcoRV)
        
            rec_vec =  ( lin_vector + pcr_prod ).looped()
        
        
        Pydna might also be useful to automate the simulation of
        `sub cloning <http://en.wikipedia.org/wiki/Subcloning>`_ experiments using
        python. This could be helpful to generate examples for teaching purposes. Read
        the `documentation <https://pydna.readthedocs.org/en/latest/>`_ or the
        `cookbook <https://www.dropbox.com/sh/u1kr30hd22zuwse/gyXYhq0BlL>`_ with example files
        for further information.
        
        An `on-line <http://pydna-shell.appspot.com/>`_ shell running Python with
        pydna is avaiable for experimentation.
        
        Please post a message in the `google group <https://groups.google.com/d/forum/pydna>`_
        for pydna if you have problems, questions or comments.
        
        Feedback in the form of questions, comments or critisism is very welcome!
        
        
        =======   ========== =============================================================
        version   date       comment
        =======   ========== =============================================================
        0.6.3     2014-07-06 Dseqrecord.add_feature can now take a string or some other
                             sequence as input. The assembly primers function can now produce 
                             primers for a circular assembly.
        
        0.6.2     2014-06-13 Dseqrecord gained three new methods:
        
                             isorf() method returning True or False.
        
                             list_features() method printa a lists all features in an
                             ASCII table.
        
                             extract_feature() extracts a feature in the form os a new
                             Dseqrecord object.
        
                             Changes to how the primer_design functions work, especially
                             assembly primers.
        
        0.6.1     2014-04-25 Fixed a bug in the Dseqrecord synced method and removed the
                             utils synced function.
        
        0.6.0     2014-04-18 Bugfixes and improvements in documentation.
        
        0.5.0     2013-12-16 Changes to how the amplify and assembly modules work
                             the Amplicon and Assembly classes are now subclasses of
                             Dseqrecord.
        
        0.2.2     2013-11-05 bugfix: changed the handling of compound features
                             to fit with the new version of BioPython (1.62) which is
                             now a requirement.
        
        0.2.1     2013-08-18 ---
        
        0.1.8     2013-06-02 bugfix: changed the SeqFeatures added to PCR products in the
                             amplify module to a dict of list of strings instead of
                             a dict of strings.
        
        0.1.7     2013-05-29 Changed the code in amplify.Amplicon to handle features
                             spanning the origin of circular sequences.
        
        0.1.6     2013-04-22 Changed the behaviour of the find method of the Dseq object
                             to find substrings that span the origin. Slicing for circular
                             Dseq objects now works slightly different.
        
        0.1.5     2013-04-18 Changed the setup.py script to permit installation
                             of the source installer without access to a c compiler.
        
        0.1.4     2013-04-10 Cleaned up some docstrings
                             Renamed Drecord -> Dseqrecord to be more consistent with
                             Dseq and Biopython Seq/SeqRecord.
        
                             Changed name of keyword argument for read and parse.
                             ds=True returns Dseqrecord(s) while ds=False returns
                             SeqRecords.
        
        0.1.3     2013-04-09 pydna created from Python-dna.
        =======   ========== =============================================================
        
        System Requirements
        ===================
        
        - `Python 2.7 <http://www.python.org>`_.
        - `Biopython >= 1.60 <http://pypi.python.org/pypi/biopython>`_.
        - `networkx >= 1.7 <http://pypi.python.org/pypi/networkx>`_.
        
        Python 2.x
        ----------
        
        This package was developed on and for Python 2.7. Other versions have not been tested.
        
        Python 3.x
        ----------
        
        This code has not been tried with Python 3. If there
        is sufficient interest, there might be a Python 3 version in the future.
        
        Installation
        ============
        
        PIP
        ---
        
        The best way of installing pydna is with pip. Pip is the
        officially `recommended <http://python-packaging-user-guide.readthedocs.org/en/latest/>`_ tool
        for installaion of Python packages from PyPi.
        Pip installs dependencies automatically.
        
        Linux:
        ::
        
         bjorn@bjorn-UL30A:~/Dropbox/pydna$ sudo pip install pydna
        
        Windows:
        ::
        
         C:\> pip install pydna
        
        If you do not have pip, you can get it by following
        these `instructions <http://www.pip-installer.org/en/latest/installing.html>`_.
        
        
        Source
        ------
        
        If you install from source, you need to install the dependencies (listed above).
        Download one of the source installers from the pypi site and extract the file.
        Open the pydna source code directory (containing the setup.py file) in
        terminal and type:
        
        python setup.py install
        
        Binary distribution
        -------------------
        
        `Binary installers <http://pypi.python.org/pypi/pydna/#downloads>`_ for 32 and 64 bit editions of MS Windows are provided.
        
        The dependencies have to be installed separately. This can be done using the
        binary installers for Windows for those who are not comfortable at the
        command line:
        
        ================ ========================================================
        Dependency       Hyperlink
        ================ ========================================================
        Python (32,64)   <http://www.python.org/download/>
        Biopython (32)   <http://biopython.org/wiki/Download>
        Biopython (64)   <http://www.lfd.uci.edu/~gohlke/pythonlibs/#biopython>
        networkx (32,64) <http://www.lfd.uci.edu/~gohlke/pythonlibs/#networkx>
        ================ ========================================================
        
        
        Source Code Repository
        ----------------------
        
        Pydna is hosted by google code: http://code.google.com/p/pydna/
        
        
        Distribution Structure
        ======================
        
        README.txt          -- This file.
        
        LICENSE.txt         -- What you can do with the code.
        
        setup.py            -- Installation file.
        
        run_tests.py        -- run tests by "python run_tests.py"<enter>
        
        pydna/              -- The code.
        
        docs/               -- Documentation and cookbook.
        
        scripts/            -- Miscellaneous and perhaps useful scripts and examples.
        
        tests/              -- Testing code.
        
        Todo
        ====
        
        * fix Dseq & Dseqrecord lower() methods so they return Dseq & Dseqrecord objects
        * inverse PCR on circular templates does not seem to preserve features of Dseqrecord objects
        * Add identification of each fragment in the Contig.small_figure method.
        
        
        
        
Keywords: bioinformatics
Platform: UNKNOWN
Classifier: Development Status :: 3 - Alpha
Classifier: Environment :: Console
Classifier: Intended Audience :: Education
Classifier: Intended Audience :: Science/Research
Classifier: License :: OSI Approved :: BSD License
Classifier: Programming Language :: Python :: 2.7
Classifier: Topic :: Education
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
